Case report: COVID-19-associated refractory thrombotic thrombocytopenic purpura complicated with Guillain-Barré syndrome.

Thrombotic thrombocytopenic purpura (TTP), a rare and lethal thrombotic microangiopathy, is an autoimmune disease that can be triggered by viral infections such as COVID-19. This condition is characterized by hemolytic microangiopathy, thrombocytopenia, and neurologic alterations, possibly accompanied by fever and renal damage. Moreover, more than 220 patients with Guillain-Barré syndrome (GBS) have been reported in association with the COVID-19 infection. In this report, we present a case of a patient who developed refractory TTP complicated by GBS following a SARS-CoV-2 infection. We aimed to highlight the importance of accurately diagnosing neurological complications associated with a COVID-19 infection and to demonstrate our strategies for treating a patient with COVID-19 infection-related refractory TTP complicated by GBS.

N-Butanol Extract of Glycyrrhizae Radix et Rhizoma Inhibits Dengue Virus through Targeting Envelope Protein.

BACKGROUND: At present, about half of the world's population is at risk of being infected with dengue virus (DENV). However, there are no specific drugs to prevent or treat DENV infection. Glycyrrhizae Radix et Rhizome, a well-known traditional Chinese medicine, performs multiple pharmacological activities, including exerting antiviral effects. The aim of this study was to investigate the anti-DENV effects of n-butanol extract from Glycyrrhizae Radix et Rhizome (GRE). METHODS: Compounds analysis of GRE was conducted via ultra-performance liquid chromatography/tandem mass spectrometry (UHPLC-MS/MS). The antiviral activities of GRE were determined by the CCK-8 assay, plaque assay, qRT-PCR, Western blotting, and the immunofluorescence assay. The DENV-infected suckling mice model was constructed to explore the antiviral effects of GRE in vivo. RESULTS: Four components in GRE were analyzed by UHPLC-MS/MS, including glycyrrhizic acid, glycyrrhetnic acid, liquiritigenin, and isoliquiritigenin. GRE inhibited the attachment process of the virus replication cycle and reduced the expression of the E protein in cell models. In the in vivo study, GRE significantly relieved clinical symptoms and prolong survival duration. GRE also significantly decreased viremia, reduced the viral load in multiple organs, and inhibited the release of pro-inflammatory cytokines in DENV-infected suckling mice. CONCLUSIONS: GRE exhibited significant inhibitory activities in the adsorption stage of the DENV-2 replication cycle by targeting the envelope protein. Thus, GRE might be a promising candidate for the treatment of DENV infection.

Plasma cell-free DNA promise monitoring and tissue injury assessment of COVID-19.

Coronavirus 2019 (COVID-19) is a complex disease that affects billions of people worldwide. Currently, effective etiological treatment of COVID-19 is still lacking; COVID-19 also causes damages to various organs that affects therapeutics and mortality of the patients. Surveillance of the treatment responses and organ injury assessment of COVID-19 patients are of high clinical value. In this study, we investigated the characteristic fragmentation patterns and explored the potential in tissue injury assessment of plasma cell-free DNA in COVID-19 patients. Through recruitment of 37 COVID-19 patients, 32 controls and analysis of 208 blood samples upon diagnosis and during treatment, we report gross abnormalities in cfDNA of COVID-19 patients, including elevated GC content, altered molecule size and end motif patterns. More importantly, such cfDNA fragmentation characteristics reflect patient-specific physiological changes during treatment. Further analysis on cfDNA tissue-of-origin tracing reveals frequent tissue injuries in COVID-19 patients, which is supported by clinical diagnoses. Hence, our work demonstrates and extends the translational merit of cfDNA fragmentation pattern as valuable analyte for effective treatment monitoring, as well as tissue injury assessment in COVID-19.

Teleworking during the COVID-19 pandemic: a leader-member exchange perspective

PurposeThe COVID-19 pandemic has accelerated the process of teleworking and teleworking is expected to be a central feature of workplaces of the future. The present study examines the effect of leader-member exchange (LMX) and perception of loneliness on the relationship between proactive coping and the work productivity of teleworkers during the COVID-19 crisis time.Design/methodology/approachUsing structural equation modeling (SEM), this study the study is based on a survey of 572 teleworkers in Taiwan drawn from a variety of industry sectors.FindingsThrough the application of a hypothesized moderated mediation model, the indirect effects of proactive coping on work productivity via LMX are stronger for employees who experience a higher level of perceived loneliness.Research limitations/implicationsThe results have contributed to current understanding on the success of telework at the individual level and extends research framework of teleworking. Using self-report questionnaire is one of the limitations;however, this was feasible data collection method during COVID-19.Practical implicationsOrganizations need to provide further training aimed at enhancing proactive coping and dealing with future work challenges in the complex and dynamic workplace.Originality/valueThis study is the first among its type to examine proactive coping and job productivity from a LMX during COVID-19.

Successful clearance of persistent SARS-CoV-2 asymptomatic infection following a single dose of Ad5-nCoV vaccine.

Persistent asymptomatic (PA) SARS-CoV-2 infections have been identified. The immune responses in these patients are unclear, and the development of effective treatments for these patients is needed. Here, we report a cohort of 23 PA cases carrying viral RNA for up to 191 days. PA cases displayed low levels of inflammatory and interferon response, weak antibody response, diminished circulating follicular helper T cells (cTfh), and inadequate specific CD4+ and CD8+ T-cell responses during infection, which is distinct from symptomatic infections and resembling impaired immune activation. Administration of a single dose of Ad5-nCoV vaccine to 10 of these PA cases elicited rapid and robust antibody responses as well as coordinated B-cell and cTfh responses, resulting in successful viral clearance. Vaccine-induced antibodies were able to neutralize various variants of concern and persisted for over 6 months, indicating long-term protection. Therefore, our study provides an insight into the immune status of PA infections and highlights vaccination as a potential treatment for prolonged SARS-CoV-2 infections.

Real-world effectiveness of primary series and booster doses of inactivated COVID-19 vaccine against Omicron BA.2 variant infection in China: a retrospective cohort study.

BACKGROUND: China has been using inactivated COVID-19 vaccines as primary series and booster doses to protect the population from severe to fatal COVID-19. We evaluated primary and booster vaccine effectiveness (VE) against Omicron BA.2 infection outcomes. METHODS: This was a 13-province retrospective cohort study of quarantined close contacts of BA.2-infected individuals. Outcomes were BA.2 infection, COVID-19 pneumonia or worse, and severe/critical COVID-19. Absolute VE was estimated by comparison with an unvaccinated group. RESULTS: There were 289,427 close-contacts ≥3 years old exposed to Omicron BA.2 cases; 31,831 turned nucleic-acid amplification test (NAAT)-positive during quarantine, 97.2% with mild or asymptomatic infection, 2.6% had COVID-19 pneumonia, and 0.15% had severe/critical COVID-19. None died. Adjusted VE against any infection was 17% for primary series and 22% when boosted. Primary series aVE in adults >18 years was 66% against pneumonia or worse infection and 91% against severe/critical COVID-19. Booster dose aVE was 74% against pneumonia or worse, and 93% against severe/critical COVID-19. CONCLUSIONS: Inactivated COVID-19 vaccines provided modest protection from infection, very good protection against pneumonia, and excellent protection against severe/critical COVID-19. Booster doses are necessary to provide strongest protection.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Mouse models susceptible to HCoV-229E and HCoV-NL63 and cross protection from challenge with SARS-CoV-2.

Human coronavirus 229E (HCoV-229E) and NL63 (HCoV-NL63) are endemic causes of upper respiratory infections such as the "common cold" but may occasionally cause severe lower respiratory tract disease in the elderly and immunocompromised patients. There are no approved antiviral drugs or vaccines for these common cold coronaviruses (CCCoV). The recent emergence of COVID-19 and the possible cross-reactive antibody and T cell responses between these CCCoV and SARS-CoV-2 emphasize the need to develop experimental animal models for CCCoV. Mice are an ideal experimental animal model for such studies, but are resistant to HCoV-229E and HCoV-NL63 infections. Here, we generated 229E and NL63 mouse models by exogenous delivery of their receptors, human hAPN and hACE2 using replication-deficient adenoviruses (Ad5-hAPN and Ad5-hACE2), respectively. Ad5-hAPN- and Ad5-hACE2-sensitized IFNAR-/- and STAT1-/- mice developed pneumonia characterized by inflammatory cell infiltration with virus clearance occurring 7 d post infection. Ad5-hAPN- and Ad5-hACE2-sensitized mice generated virus-specific T cells and neutralizing antibodies after 229E or NL63 infection, respectively. Remdesivir and a vaccine candidate targeting spike protein of 229E and NL63 accelerated viral clearance of virus in these mice. 229E- and NL63-infected mice were partially protected from SARS-CoV-2 infection, likely mediated by cross-reactive T cell responses. Ad5-hAPN- and Ad5-hACE2-transduced mice are useful for studying pathogenesis and immune responses induced by HCoV-229E and HCoV-NL63 infections and for validation of broadly protective vaccines, antibodies, and therapeutics against human respiratory coronaviruses including SARS-CoV-2.

COVID-19 epidemic and public health interventions in Shanghai, China: Statistical analysis of transmission, correlation and conversion.

Background: The Shanghai COVID-19 epidemic is an important example of a local outbreak and of the implementation of normalized prevention and disease control strategies. The precise impact of public health interventions on epidemic prevention and control is unknown. Methods: We collected information on COVID-19 patients reported in Shanghai, China, from January 30 to May 31, 2022. These newly added cases were classified as local confirmed cases, local asymptomatic infections, imported confirmed cases and imported asymptomatic infections. We used polynomial fitting correlation analysis and illustrated the time lag plot in the correlation analysis of local and imported cases. Analyzing the conversion of asymptomatic infections to confirmed cases, we proposed a new measure of the conversion rate (C r ). In the evolution of epidemic transmission and the analysis of intervention effects, we calculated the effective reproduction number (R t ). Additionally, we used simulated predictions of public health interventions in transmission, correlation, and conversion analyses. Results: (1) The overall level of R t in the first three stages was higher than the epidemic threshold. After the implementation of public health intervention measures in the third stage, R t decreased rapidly, and the overall R t level in the last three stages was lower than the epidemic threshold. The longer the public health interventions were delayed, the more cases that were expected and the later the epidemic was expected to end. (2) In the correlation analysis, the outbreak in Shanghai was characterized by double peaks. (3) In the conversion analysis, when the incubation period was short (3 or 7 days), the conversion rate fluctuated smoothly and did not reflect the effect of the intervention. When the incubation period was extended (10 and 14 days), the conversion rate fluctuated in each period, being higher in the first five stages and lower in the sixth stage. Conclusion: Effective public health interventions helped slow the spread of COVID-19 in Shanghai, shorten the outbreak duration, and protect the healthcare system from stress. Our research can serve as a positive guideline for addressing infectious disease prevention and control in China and other countries and regions.

COVID-19 epidemic and public health interventions in Shanghai, China: Statistical analysis of transmission, correlation and conversion

Background The Shanghai COVID-19 epidemic is an important example of a local outbreak and of the implementation of normalized prevention and disease control strategies. The precise impact of public health interventions on epidemic prevention and control is unknown. Methods We collected information on COVID-19 patients reported in Shanghai, China, from January 30 to May 31, 2022. These newly added cases were classified as local confirmed cases, local asymptomatic infections, imported confirmed cases and imported asymptomatic infections. We used polynomial fitting correlation analysis and illustrated the time lag plot in the correlation analysis of local and imported cases. Analyzing the conversion of asymptomatic infections to confirmed cases, we proposed a new measure of the conversion rate (Cr). In the evolution of epidemic transmission and the analysis of intervention effects, we calculated the effective reproduction number (Rt). Additionally, we used simulated predictions of public health interventions in transmission, correlation, and conversion analyses. Results (1) The overall level of Rt in the first three stages was higher than the epidemic threshold. After the implementation of public health intervention measures in the third stage, Rt decreased rapidly, and the overall Rt level in the last three stages was lower than the epidemic threshold. The longer the public health interventions were delayed, the more cases that were expected and the later the epidemic was expected to end. (2) In the correlation analysis, the outbreak in Shanghai was characterized by double peaks. (3) In the conversion analysis, when the incubation period was short (3 or 7 days), the conversion rate fluctuated smoothly and did not reflect the effect of the intervention. When the incubation period was extended (10 and 14 days), the conversion rate fluctuated in each period, being higher in the first five stages and lower in the sixth stage. Conclusion Effective public health interventions helped slow the spread of COVID-19 in Shanghai, shorten the outbreak duration, and protect the healthcare system from stress. Our research can serve as a positive guideline for addressing infectious disease prevention and control in China and other countries and regions.

Effective vaccination strategy using SARS-CoV-2 spike cocktail against Omicron and other variants of concern.

The SARS-CoV-2 Omicron variant harbors more than 30 mutations in its spike (S) protein. Circulating Omicron subvariants, particularly BA5 and other variants of concern (VOCs), show increased resistance to COVID-19 vaccines that target the original S protein, calling for an urgent need for effective vaccines to prevent multiple SARS-CoV-2 VOCs. Here, we evaluated the neutralizing activity and protection conferred by a BA1-S subunit vaccine when combined with or used as booster doses after, administration of wild-type S protein (WT-S). A WT-S/BA1-S cocktail, or WT-S prime and BA1-S boost, induced significantly higher neutralizing antibodies against pseudotyped Omicron BA1, BA2, BA2.12.1, and BA5 subvariants, and similar or higher neutralizing antibodies against the original SARS-CoV-2, than the WT-S protein alone. The WT-S/BA1-S cocktail also elicited higher or significantly higher neutralizing antibodies than the WT-S-prime-BA1-S boost, WT-S alone, or BA1-S alone against pseudotyped SARS-CoV-2 Alpha, Beta, Gamma, and Delta VOCs, and SARS-CoV, a closely related beta-coronavirus using the same receptor as SARS-CoV-2 for viral entry. By contrast, WT-S or BA1-S alone failed to induce potent neutralizing antibodies against all these viruses. Similar to the WT-S-prime-BA1-S boost, the WT-S/BA1-S cocktail completely protected mice against the lethal challenge of a Delta variant with negligible weight loss. Thus, we have identified an effective vaccination strategy that elicits potent, broadly, and durable neutralizing antibodies against circulating SARS-CoV-2 Omicron subvariants, other VOCs, original SARS-CoV-2, and SARS-CoV. These results will provide useful guidance for developing efficacious vaccines that inhibit current and future SARS-CoV-2 variants to control the COVID-19 pandemic.

Safety and immunogenicity of a mosaic vaccine booster against Omicron and other SARS-CoV-2 variants: a randomized phase 2 trial.

An ongoing randomized, double-blind, controlled phase 2 trial was conducted to evaluate the safety and immunogenicity of a mosaic-type recombinant vaccine candidate, named NVSI-06-09, as a booster dose in subjects aged 18 years and older from the United Arab Emirates (UAE), who had administered two or three doses of inactivated vaccine BBIBP-CorV at least 6 months prior to enrollment. The participants were randomly assigned with 1:1 to receive a booster dose of NVSI-06-09 or BBIBP-CorV. The primary outcomes were immunogenicity and safety against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) Omicron variant, and the exploratory outcome was cross-immunogenicity against other circulating strains. Between May 25 and 30, 2022, 516 adults received booster vaccination with 260 in NVSI-06-09 group and 256 in BBIBP-CorV group. Interim results showed a similar safety profile between two booster groups, with low incidence of adverse reactions of grade 1 or 2. For immunogenicity, by day 14 post-booster, the fold rises in neutralizing antibody geometric mean titers (GMTs) from baseline elicited by NVSI-06-09 were remarkably higher than those by BBIBP-CorV against the prototype strain (19.67 vs 4.47-fold), Omicron BA.1.1 (42.35 vs 3.78-fold), BA.2 (25.09 vs 2.91-fold), BA.4 (22.42 vs 2.69-fold), and BA.5 variants (27.06 vs 4.73-fold). Similarly, the neutralizing GMTs boosted by NVSI-06-09 against Beta and Delta variants were also 6.60-fold and 7.17-fold higher than those by BBIBP-CorV. Our findings indicated that a booster dose of NVSI-06-09 was well-tolerated and elicited broad-spectrum neutralizing responses against divergent SARS-CoV-2 variants, including Omicron and its sub-lineages.

Mindfulness and mental health in medical staff in the COVID-19 period: Mediating role of perceived social support and sense of security

This study examined the association between mindfulness and the mental health outcomes of medical staff during the COVID-19 outbreak period. We also explored the perceived social support and sense of security as mediators in this relationship. The participants were 400 medical staff (male= 23%, female= 77%;14.8% with suspected exposure to COVID-19) from China. The medical staff completed the Mindful Attention Awareness Scale (MAAS), Perceived Social Support Scale (SSS), Security Questionnaire (SQ), Self-Rating Depression Scale (SDS), and General Well-being Scale (GWB). The path analysis results showed that mindfulness was associated with lower depression symptoms and higher subjective well-being. The medical staffwho perceived higher social support and s sense of security had lower mental distress and higher well-being. Perceived social support enhanced mental health and well-being through the sense of security. The predictive effect of perceived social support on the sense of security of medical staff who had contact with suspected COVID-19 patients was significantly stronger than that of medical staff did not have suspected COVID-19 contact. These findings indicate a need to provide more mindfulness-related training (e.g., Mindfulness-Based Stress Reduction, MBSR) to improve the mental health of medical staff and provide more support to ensure their sense of security. In addition, more humanistic care and material resources should be provided to medical staff in high-risk departments. [ FROM AUTHOR]

Genetic characterization of SARS-CoV-2 from cross-border trucks and containers in Kashgar Prefecture, Xinjiang Uygur Autonomous Region, China

Kashgar is a prefecture in Xinjiang Uygur Autonomous Region. China. Kashgar Prefecture (KP) is a land-cargo port connecting China with central Asian countries and Europe. Frequent transportation of cargo has increased the risk of severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) introduction into China, which has increased the pressure on coronavirus disease-2019 (COVID-19) prevention and control. In November 2020, an imported virus-induced COVID-19 outbreak occurred in KP. To investigate the genetic characterization of SARS-CoV-2 that contaminated the trucks and containers, and the potential of border rapid logistics system to serve as carriers for SARS-CoV-2 transmission, thirty-five SARS-CoV-2-positive nucleic-acid samples collected from KP cross-border trucks and containers from 6-10 November 2020 were subjected into SARS-CoV-2 genomic sequencing and comparative analyses. The results showed that the median (minimum to maximum) Ct value of ORF1ab was 37.64 (28.91-39.81) . and that of the N gene was 36.50 (26.35-39.30), and the median (minimum to maximum) of the reads mapping ratio to SARS-CoV-2 was 51.95% (0.86%-99.31%), which indicated low viral loads in these environmental samples. Eighteen of 35 samples had genomic coverage >70%. According to the Pango nomenclature, 18 SARS-CoV-2 sequences belonged to six lineages (B.1, B.I.1, B.1.9. B.1.1.220, B.1.153 and B.1.465), three of which (B.I. B.1.1 and 8.1.153) were found in case samples from the same period of four China-neighboring countries. Analyses of nucleotide mutations and phylogenetic trees showed that the genome sequences of SARS-CoV-2 collected from the same location were similar. Four of 18 sequences were in a sub-lineage with the representative strain of COVID-19 outbreak in KP, one of which had 1 or 2 differences in nucleotide mutation sites with the strain that caused the COVID-19 outbreak in KP, which indicated high homology in the viral genome. We showed that cross-border trucks and containers were contaminated by various genotypes of SARS-CoV-2 from other countries during the outbreak in KP. and in which contained the parental virus of the KP cases. These trucks and containers served as carriers for SARS-CoV-2 introduction from other countries to cause local transmission. Our results provide important references for COVID-19 prevention-and-control strategies in border ports and tracing of outbreak sources in China.

Structural basis for mouse receptor recognition by SARS-CoV-2 omicron variant.

The sudden emergence and rapid spread of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) omicron variant has raised questions about its animal reservoir. Here, we investigated receptor recognition of the omicron's receptor-binding domain (RBD), focusing on four of its mutations (Q493R, Q498R, N501Y, and Y505H) surrounding two mutational hotspots. These mutations have variable effects on the RBD's affinity for human angiotensin-converting enzyme 2 (ACE2), but they all enhance the RBD's affinity for mouse ACE2. We further determined the crystal structure of omicron RBD complexed with mouse ACE2. The structure showed that all four mutations are viral adaptations to mouse ACE2: three of them (Q493R, Q498R, and Y505H) are uniquely adapted to mouse ACE2, whereas the other one (N501Y) is adapted to both human ACE2 and mouse ACE2. These data reveal that the omicron RBD was well adapted to mouse ACE2 before omicron started to infect humans, providing insight into the potential evolutionary origin of the omicron variant.

Commercial Real Estate Market at a Crossroads: The Impact of COVID-19 and the Implications to Future Cities

This paper aims to examine the responses of commercial real estate markets to COVID-19 and the implications for post-pandemic cities. Using data of Florida’s metropolitan areas in a fixed effect regression model, we find that sales volumes of retail properties decline instantly under the shock of COVID-19 but are followed by a strong recovery after one quarter. Meanwhile, COVID-19 depresses the growth rate of rent for office property, but the impact is short-term, and the office rental market bounces back to about 70 percent one quarter later. In comparison, industrial properties witness a rise in the growth rate of sales and rent price. Results indicate that urban planners may consider adjusting the amount of lands allocated to different usages to meet the evolving demands of urban space in the post-pandemic era.

Wiping conditions and fabric properties influenced the microfiber shedding from non-woven products.

Disposable wipes and masks have come to be considered as underestimated sources of microfiber generation since the emergence of COVID-19. However, research into the creation of microfibers due to wiping with these non-woven products is scarce, and the potential effects of fabric properties on shedding behavior are unclear. This study investigated microfiber release from 7 wet wipes, 5 dry wipes, and 4 masks in response to the use of simulated daily wiping conditions on artificial skin. The dry wipes (77-568 p per sheet) shed more microfibers than the wet ones (21-190 p per sheet) after 2, 10, or 50 wiping cycles under a 9.8 N wiping force. In addition, an average of 56 microfibers could be released from per gram of wipe, and each square centimeter of wipe could release about 1.18 microfibers during wiping. Masks shed fewer microfibers than wipes due to the excellent shedding resistance of spunbond nonwoven fabrics and the strengthened mechanical properties granted by bonding points. Cellulose, polyethylene terephthalate (PET), and polypropylene (PP) were the major polymers in the microfibers shed by wipes, and the microfibers from masks were all PP. With regard to the influencing factors, the number of microfibers shed from wipes was positively associated with the number of wiping cycles (r = 0.983 and 0.960, p < 0.01) and wiping force (r = 0.980, p < 0.05), while it was negatively correlated with the moisture content (r = -0.992, p < 0.01). Interestingly, a stronger fiber entanglement degree in the wipes significantly improved the resistance to microfiber generation (r = -0.664, p < 0.05). The results highlighted for the first time that the bending coefficient (ß = -5.05; 95% CI: -7.71, -2.40; p = 0.002) and fiber extraction force (ß = -0.077; 95% CI: -0.123, -0.030; p = 0.005) significantly reduced the tendency for microfiber shedding. Although the number of microfibers shed from wiping was lower than those from domestic washing, there is still an urgent need to control the microfiber shedding tendencies of non-woven products through improving the manufacturing processes.

A mosaic-type trimeric RBD-based COVID-19 vaccine candidate induces potent neutralization against Omicron and other SARS-CoV-2 variants.

Large-scale populations in the world have been vaccinated with COVID-19 vaccines, however, breakthrough infections of SARS-CoV-2 are still growing rapidly due to the emergence of immune-evasive variants, especially Omicron. It is urgent to develop effective broad-spectrum vaccines to better control the pandemic of these variants. Here, we present a mosaic-type trimeric form of spike receptor-binding domain (mos-tri-RBD) as a broad-spectrum vaccine candidate, which carries the key mutations from Omicron and other circulating variants. Tests in rats showed that the designed mos-tri-RBD, whether used alone or as a booster shot, elicited potent cross-neutralizing antibodies against not only Omicron but also other immune-evasive variants. Neutralizing antibody ID50 titers induced by mos-tri-RBD were substantially higher than those elicited by homo-tri-RBD (containing homologous RBDs from prototype strain) or the BIBP inactivated COVID-19 vaccine (BBIBP-CorV). Our study indicates that mos-tri-RBD is highly immunogenic, which may serve as a broad-spectrum vaccine candidate in combating SARS-CoV-2 variants including Omicron.

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic continues to pose a serious threat to public health and has so far resulted in over six million deaths worldwide. Mass vaccination programs have reduced the risk of serious illness and death in many people, but the virus continues to persist and circulate in communities across the globe. Furthermore, the current vaccines may be less effective against the new variants of the virus, such as Omicron and Delta, which are continually emerging and evolving. Therefore, it is urgent to develop effective vaccines that can provide broad protection against existing and future forms of SARS-CoV-2. There are several different types of SARS-CoV-2 vaccine, but they all work in a similar way. They contain molecules that induce immune responses in individuals to help the body recognize and more effectively fight SARS-CoV-2 if they happen to encounter it in the future. These immune responses may be so specific that new variants of a virus may not be recognized by them. Therefore, a commonly used strategy for producing vaccines with broad protection is to make multiple vaccines that each targets different variants and then mix them together before administering to patients. Here, Zhang et al. took a different approach by designing a new vaccine candidate against SARS-CoV2 that contained three different versions of part of a SARS-CoV2 protein ­ the so-called spike protein ­ all linked together as one molecule. The different versions of the spike protein fragment were designed to include key features of the fragments found in Omicron and several other SARS-CoV-2 variants. The experiments found that this candidate vaccine elicited a much higher immune response against Omicron and other SARS-CoV-2 variants in rats than an existing SARS-CoV-2 vaccine. It was also effective as a booster shot after a first vaccination with the existing SARS-CoV-2 vaccine. These findings demonstrate that the molecule developed by Zhang et al. induces potent and broad immune responses against different variants of SARS-CoV-2 including Omicron in rats. The next steps following on from this work are to evaluate the safety and immunogenicity of this vaccine candidate in clinical trials. In the future, it may be possible to use a similar approach to develop new broad-spectrum vaccines against other viruses.

Serum metabolomic abnormalities in survivors of non-severe COVID-19.

Metabolic reprogramming is a distinctive characteristic of SARS-CoV-2 infection, which refers to metabolic changes in hosts triggered by viruses for their survival and spread. It is current urgent to understand the metabolic health status of COVID-19 survivors and its association with long-term health consequences of infection, especially for the predominant non-severe patients. Herein, we show systemic metabolic signatures of survivors of non-severe COVID-19 from Wuhan, China at six months after discharge using metabolomics approaches. The serum amino acids, organic acids, purine, fatty acids and lipid metabolism were still abnormal in the survivors, but the kynurenine pathway and the level of itaconic acid have returned to normal. These metabolic abnormalities are associated with liver injury, mental health, energy production, and inflammatory responses. Our findings identify and highlight the metabolic abnormalities in survivors of non-severe COVID-19, which provide information on biomarkers and therapeutic targets of infection and cues for post-hospital care and intervention strategies centered on metabolism reprogramming.